PolyPlex®

High-throughput, Oligo Synthesis in a 96-well Format

GeneMachines® PolyPlex® is a fast, cost-effective 96-well oligonucleotide synthesizer that generates a full plate of 20-mers in less than 3.0 hours. This second generation PolyPlex® features up to 8 amidite positions for synthesizing DNA or RNA with specialty labels.

The PolyPlex® features several novel technologies that make it an unrivaled, high-throughput synthesizer. Parallel dispensing of reagents reduces both synthesis time and reagent consumption, while also eliminating the flushing of reagent lines. Robust valves with low dead volumes provide the foundation for low cost synthesis. Different synthesis scales are readily available, up to 1 umol, using cartridges. With 1.6 hours of operator activity, 96 oligos can be set-up, synthesized, cleaved, de-protected and dried. Synthesis progress can be monitored using full-plate trityl collection after any base addition (in situ QC).

The powerful PolyPlex® Software comes with validated synthesis protocols and includes push-button protocol editing for custom chemistries. The Software also offers flexible importing of sequence and synthesis in 96-well format, ideal features for seamless integration with the product line of OmniGrid® microarrayers, slides and reagents.

Features:

  • Fast, high-throughput synthesis
  • Up to 4 auxiliary positions for special chemistries
  • Less than $0.10 per base
  • Low Argon consumption
  • Highly reliable and long lasting valves
  • Convenient 96-well plate format
  • User-friendly software with flexible sequence loading

Resources:

To see the available documents we have for the PolyPlex®, please visit our technical library for further information. The following documents are currently available:

  • PolyPlex® Technical Note – Oligonucleotide Arraying
  • PolyPlex® Data Sheet

Spare Parts:

Typical Applications:


[back to top]

PolyPlex®

PolyPlex®

20-mer prepared with the PolyPlex® in 2.7 hours:
CGATGCTATGGATGTGGATG


Click above image to see enlarged Graph of PolyPlex® Results

50-mer prepared with the PolyPlex® in 7 hours:
GAATTCCAGACCAACCTGGTGCCCT ACCCCCGCATCCACTTCCCTCTGGC


Click above image to see enlarged Graph of PolyPlex® Results